RegulonDB RegulonDB 10.9: Gene Sequence
iraM gene sequence


Size: 324        A: 113  T: 101  G: 54  C: 56

Fasta

 

>iraM E. coli K12. Version NC_000913.3 GI:556503834
atgaagtggatagtaattgacacggtaattcaacctacatgtggtatatctttttcagcc
atatggggtaatatgaaaatgatcatctggtatcaatctactatatttctccctcctggc
agtatatttacaccggttaagtctggtattatccttaaggataaagaatatcctattact
atttatcacatcgcaccattcaacaaggatttatggagtttactcaaaagcagtcaagag
tgtcctccaggagaaagcaaaataacaaataaatgtttacataatagttgcattataaaa
atatgcccatatgggctcaagtaa
              
                            

Download fasta file
RegulonDB