RegulonDB RegulonDB 10.9: Gene Sequence
ycgX gene sequence


Size: 405        A: 135  T: 121  G: 79  C: 70

Fasta

 

>ycgX E. coli K12. Version NC_000913.3 GI:556503834
atggatcaggtcgttgtttttcaaaagatgtttgagcaagtgagaaaagagcaaaacttc
tcctggttttattcagaattaaaacatcaccgtattgcacattacatttattatctggct
acggataacatcagaattattactcacgatgatacggttttgttattaagaggaaccagg
aacctgttaaaagttagtacgaccaagaaccctgctaaaataaaagaggccgcattgctt
catatttgcggaaaatctacatttcgggaatactgttcaacactggcaggcgcgggcgtt
ttccggtgggttactgatgttaatcataacaaacgcagttactacgccattgataatacg
cttttatatattgaagatgtagaaaataataaaccattaatctag
              
                            

Download fasta file
RegulonDB