RegulonDB RegulonDB 10.9: Gene Sequence
bluF gene sequence


Size: 1212        A: 345  T: 339  G: 270  C: 258

Fasta

 

>bluF E. coli K12. Version NC_000913.3 GI:556503834
atgcttaccacccttatttatcgtagccatatacgtgacgacgaacctgtcaaaaaaatc
gaagaaatggtttcgatagcaaatcgcaggaacatgcagtctgacgtaacagggatctta
ctgtttaatggttctcattttttccagcttctggaaggtccggaagaacaggttaaaatg
atatatcgggctatatgccaggatccacggcactataatattgttgagctgctgtgcgat
tacgcgcctgctcgccgttttggcaaagcgggaatggaattatttgatttgcgcctgcac
gagcgagatgacgttttacaggccgtattcgacaaaggcacatcaaaatttcagctaact
tatgatgacagagcgctacaattttttcgtacttttgtccttgcaaccgaacaatcaacc
tatttcgagatccctgccgaagactcctggctttttatcgctgacggatctgataaagaa
cttgattcctgtgccctttcaccaactataaacgaccactttgcctttcatcctattgtc
gatcccttatcgcggcggataatcgcttttgaagccattgtgcaaaaaaatgaagatagc
ccatcagccatagcggttgggcagcgtaaagacggggaaatctacacagcggatctcaaa
agtaaggcgcttgcattcacgatggcacacgcacttgagctcggtgataaaatgatttca
atcaatctattacctatgaccctggttaacgaacctgacgcagtctcttttttacttaat
gaaataaaggccaatgctctggtgcctgaacaaatcatcgttgaatttactgaaagtgaa
gtcatatctcggtttgatgagtttgccgaagcgattaaatcgctaaaggctgctggtatc
agtgtagcaattgatcattttggcgcaggttttgctggtttgttactcctgtcacgcttc
cagcctgacagaattaaaatcagtcaggaattgattaccaatgttcataaaagtgggcca
cggcaggcaattattcaggcgatcataaaatgctgtacatcacttgaaattcaagtcagt
gctatgggcgtggcaacaccagaagagtggatgtggcttgaatccgcaggaattgagatg
tttcagggagatctgtttgctaaagctaaattgaatggtatcccttccatagcgtggcca
gagaaaaaataa
              
                            

Download fasta file
RegulonDB