RegulonDB RegulonDB 10.9: Gene Sequence
ycgZ gene sequence


Size: 237        A: 73  T: 65  G: 56  C: 43

Fasta

 

>ycgZ E. coli K12. Version NC_000913.3 GI:556503834
atgcatcaaaattcagtgactttagattctgcgggagcaatcactcgttactttgcaaaa
gctaacttgcatactcagcaggaaactctcggggaaattgtgactgagattttgaaagat
ggacgtaatctgagtcgaaagtcgctttgtgccaaacttctttgccgactggaacacgcg
actggggaagaggaacagaaacattataatgcactaattgggttgctttttgaataa
              
                            

Download fasta file
RegulonDB