RegulonDB RegulonDB 10.9: Gene Sequence
pdeG gene sequence


Size: 1524        A: 408  T: 436  G: 340  C: 340

Fasta

 

>pdeG E. coli K12. Version NC_000913.3 GI:556503834
atgcgcaatacactcatacccatcctcgttgcgatatgcttgtttattaccggtgtcgct
attttgaacatccagctctggtattccgcaaaagcagagtacctggcgggagcgagatat
gccgccaacaatatcaatcatatacttgaagaagcgtcacaagcgactcaaacagcggtt
aacattgccgggaaggaatgcaacctcgaggagcaatatcagcttggcactgaagcagct
ctgaaacctcacctgcgcacaatcatcattctcaaacagggaatagtctggtgtacatcc
ctgcctgggaatcgggtcctgttgtctcgtattcctgttttcccggacagtaatttactg
ttggctccagcaatcgacaccgttaatagattacctatcctgctctatcagaaccaattt
gcagatacgcgcattttggttacgataagcgatcagcatattcgtggggcacttaatgta
cccttgaaaggggtaaggtatgtattacgcgtggcggatgacattattggaccaacgggt
gatgtgatgacgcttaatggacattatccctataccgagaaggttcactccacaaaatat
catttcactattatctttaacccgccgccactctttagcttctacagacttatcgataaa
ggctttgggattttaatatttattctgttaatcgcctgcgccgctgccttcctgcttgat
agatatttcaataaaagcgcaacgcctgaagagatcctgcgacgggcaataaataatggg
gagatcgtccctttttaccaacctgtggtaaatggtcgggaagggacattgcggggagtt
gaggtgttagcccgctggaaacaacctcacggtggatatatatcacccgcggcatttatt
ccacttgctgaaaaatccggattaatcgttccgcttacgcaaagcctgatgaatcaggtt
gccagacagatgaacgctatcgcgagtaaattgccggaaggttttcatattggaattaat
tttagcgcttcgcatattatttcgccgacgtttgtcgacgagtgtttaaatttccgtgac
agttttacccgccgcgatttaaaccttgttctggaagtcaccgagcgtgagccattgaat
gttgatgaaagtctggttcagcggttgaacatactgcatgaaaatggttttgtcatcgca
ctggatgatttcggtactggctactcagggctttcttatcttcatgacctgcatattgat
tatatcaaaattgatcacagtttcgttggccgcgtaaacgcagacccagaatcaacccga
attctggattgtgtattggatctggcgcgtaaactttcgatcagtatcgtcgctgaaggt
gtcgaaacgaaagaacaacttgactatctgaaccaaaattatatcacatttcagcagggt
tattatttctataaacctgttacatacatcgacctggtcaaaattatcctttctaaaccg
aaggtgaaggttgtggttgagtga
              
                            

Download fasta file
RegulonDB