RegulonDB RegulonDB 10.9: Gene Sequence
ycgH gene sequence


Size: 2648        A: 814  T: 688  G: 649  C: 497

Fasta

 

>ycgH E. coli K12. Version NC_000913.3 GI:556503834
atgaaactgaaaaaactccccgggtttagtttgggacttattgctctggcggtgggtaat
gcatatgcaacacaattgttggatgattatagtataatttcctatatgactgatgaagaa
tcgccgattgaaatcaaagataataatccgataagtaatggagagtatctaaccactgaa
gacgaaagccatgctgtgaaagtggatgacggtgtaactggatatataaataatgccagt
gtgatgactagtggtgatggatcttatggtatttctgttgatagtcaaaacaaagtatta
tatataagcgatagcgatattaagacctctggaagcgtatctgacaaagaaaatggaggg
ataacagccagcgcagtagtcagtgaatttggtggcaccatctttatgaatggtgataat
tcagtcgagtcgggtggggcatattcagcgggacttttaagccaggttaatgattctgaa
aagatggtaaataacacccgtcttgaaaccacagataaaacgaacattgttacctctggg
gaaaatgcagtaggtgttcttgcatgttcaagtcctggagagtctcgaacatgtgtcgat
gctgtagatgatgaagttagtgattctaacagttacgaagttattagccgtgctgattta
aaaatgaatggtggttccataacaactaatggcattaatagctatggtgcttatgctaat
gggaaaaaagcatatattaatttagattatgtggcacttgaaactgtggctgatggaagt
tatgcagttgctattcgacaaggtaacattgatataaaaaatagttctattacaacaaca
ggcactaaagcccccattgcaaaaatatacaatggtggagagttatttttttccaatgtc
accgcggtatcaaaacaagataaaggaatatcaattgatgcatcaaatatcgattctcaa
gccaaaatagcactattaagtgttgaactttcaagtgctttggatagtattgatgttaac
aaaactacaacggatgtaagtatccttaatcgaagtattatcacacctggtaataatgtt
ctggttaataatactggaggtgacttaaacataatttcgtccgactctattctaaatgga
gcgactaaactcgtcagcggcacaaccacgctgaagctttcagaaaatacaatctggaat
atgaaagatgactccgttgttacccatctgactaattcagacagtattatcaatctttcg
tatgatgatggtcaaacatttacccaaggaaaaacattaaccgtaaaaggtaattatgtc
ggtaataatggtcagcttaatatccgcaccgtattaggtgatgataaatcggctacggac
agacttattgttgagggtaatacttcgggttcaactaccgtctatgtgaaaaatgctgga
ggaagcggcgcggccacgctaaacgggatcgaactcataactgtgaatggcgatgaatct
ccagcagatgccttcagataaggtgatgcaaggattgcagctggagctttcgaatatcaa
ctaaaacaacaaggcaaaaactggtatttgacaagttatcagtcagtgaatgaggaggat
aacagctcagagggaaattcagaatcaacagaaacgcctacccccgtcctgcgccccgaa
gctggaagttacgtcgctaacctggcagctgctaacactctttttgttatgcgtctgaac
gaccgtgcgggtgaaacgcgctacatcgatcctgtaactgaacaggagcgttcaagccga
ctttggctacgtcaaattggcgggcataatgcctggcgtgacagcaacggacagttgaga
acgacctcgcatcgctacgtctcgcagttagggggcgatctgttaaccggtggttttacc
gatagtgacagttggcgtttgggagtgatggctggttatgcccgcgactacaacttaact
cattccagcgtgtcggattatcgttcgaaagggagtgtcagaggctatagcgcagggctg
tatgccacctggtttgccgatgacatcagtaaaaaaggcgcatacattgactcctgggcg
caatatagctggtttaaaaactcggtgaaaggggatgaattagcctatgaatcctatagc
gcgaaaggtgcaaccgtctcgctggaagcgggttacggttttgccctgaataaatccttt
ggtctggaagcggcgaaatatacgtggatcttccagccacaggcacaggctatctggatg
ggcgtcgatcataatgcgcacacggaagccaatggctcacgtattgagaatgacgcaaat
aacaacatccagacccgactcggcttccgcacctttattcgtactcaggagaaaaacagc
ggtccgcacggtgacgactttgaaccttttgttgaaatgaactggatccataacagtaaa
gattttgctgtctcaatgaacggtgtgaaagtcgaacaagatggggcgagtaatttgggg
gaaattaaacttggcgtaaatggcaacctgaatccagcggccagcgtctggggaatgtgg
gcgtgcagctgggtgataatggctacaatgacaccgcagtgatggtgggcctgaaatata
agttctga
              
                            

Download fasta file
RegulonDB