RegulonDB RegulonDB 10.9: Gene Sequence
ymgD gene sequence


Size: 330        A: 105  T: 76  G: 80  C: 69

Fasta

 

>ymgD E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaatttgctttactggcgggcctgtttgttttcgcaccaatgacctgggcgcag
gactacaatattaaaaacggtttgccgtcagaaacctatattacttgcgcagaagccaac
gaaatggcaaaaactgacagcgcacaggttgcagaaattgttgcggtaatgggtaatgcc
agcgttgccagccgtgatttaaaaattgagcaatctccggaactgagcgccaaagtggta
gaaaaactgaatcaggtttgcgctaaagacccgcaaatgctgttgatcacggcaattgat
gacaccatgcgtgctatcggcaaaaaataa
              
                            

Download fasta file
RegulonDB