RegulonDB RegulonDB 10.9: Gene Sequence
ycgJ gene sequence


Size: 369        A: 103  T: 110  G: 93  C: 63

Fasta

 

>ycgJ E. coli K12. Version NC_000913.3 GI:556503834
atgaatatgatgcgtattttttatatcggattgtcaggtgtggggatgatgttctcatca
atggcgtctggaaatgacgctggcggacttcaatctccggcgtgcggcgttgtttgcgac
ccgtatatttgtgtgaactcagatggcatttccccagagttaacaaggaaatatctcggc
gaaaaagccgctgaaaacttacaatcattacaaggctacgatcccagcgaatttacattc
gctaacggtgtattttgcgatgttaaagaaaaattatgtcgtgatgatcgttattttggt
gtggatggtaagcggagtggaaaaatcaatcaaaccaccacaaagatgttatttatgtgt
cgtgagtga
              
                            

Download fasta file
RegulonDB