RegulonDB RegulonDB 10.9: Gene Sequence
pliG gene sequence


Size: 402        A: 133  T: 96  G: 85  C: 88

Fasta

 

>pliG E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatcaagagcatcaggaaggctgtattgctgcttgcactgctaacctccacgagc
tttgctgcgggtaagaatgtcaatgttgagttcagaaaaggccatagcagcgctcagtac
tccggcgaaataaagggatacgattacgatacatataccttctatgccaaaaaaggtcag
aaagtgcatgtgagtatctctaatgaaggcgctgatacttacctcttcgggccaggaatc
gatgattcagttgatttatccagatattccccagaactcgatagtcacggacaatactca
ctccctgcttctggcaaatatgagctgcgagtgttgcaaacccgaaacgacgcccgtaaa
aacaaaactaaaaaatataacgtcgatattcaaattaagtaa
              
                            

Download fasta file
RegulonDB