RegulonDB RegulonDB 10.9: Gene Sequence
ycgL gene sequence


Size: 327        A: 105  T: 81  G: 77  C: 64

Fasta

 

>ycgL E. coli K12. Version NC_000913.3 GI:556503834
atgccaaaacctggcatcttaaagagtaaaagtatgttttgtgtgatttatcgaagcagc
aagcgtgaccagacctatttatatgtcgaaaaaaaagacgatttttcgcgtgttcctgag
gaactgatgaaaggttttggtcagcctcagttagcgatgattctgccgctggatgggcgg
aagaaactggtcaatgccgatattgaaaaggttaaacaggcattaaccgagcaaggttac
tatttgcagttaccgccaccacccgaagatttgctgaagcaacatctttccgtcatgggg
cagaaaacagacgacactaacaaataa
              
                            

Download fasta file
RegulonDB