RegulonDB RegulonDB 11.0: Gene Sequence
ycgM gene sequence


Size: 660        A: 162  T: 155  G: 187  C: 156

Fasta

 

>ycgM E. coli K12. Version NC_000913.3 GI:556503834
atgtatcaacatcacaactggcaaggtgcgctgctggattatccggtgagtaaagtagtc
tgtgttggcagtaactatgccaaacatattaaagagatgggcagcgcagtgcccgaagag
ccagtgctgtttattaaaccagaaacggcactgtgcgatctgcggcagccattggcgatc
ccatccgatttcggttcagttcatcatgaagtcgaactggcggtgttgattggcgcgaca
ctgcgtcaggctacggaagagcatgtccgcaaagccattgccggttatggcgtggcgctc
gatctgacattgcgtgatgttcagggaaaaatgaagaaagccgggcagccgtgggaaaag
gctaaagcgtttgataactcttgtccgctttccgggtttattcccgcggcggaatttacc
ggcgacccgcaaaatacaacgctgagcctgagcgtaaacggcgaacaacgccagcaaggt
acgactgcggacatgatccataaaatcgttccgctgatcgcttatatgagcaagtttttt
accctcaaggccggtgacgttgtgttgacaggcacgcctgatggcgtcggcccgttgcaa
agcggtgatgagctgacagtcactttcgatgggcattctttgacaactcgcgttttgtaa
              
                            

Download fasta file
RegulonDB