RegulonDB RegulonDB 10.8: Gene Sequence
hlyE gene sequence


Size: 912        A: 310  T: 227  G: 197  C: 178

Fasta

 

>hlyE E. coli K12. Version NC_000913.3 GI:556503834
atgactgaaatcgttgcagataaaacggtagaagtagttaaaaacgcaatcgaaaccgca
gatggagcattagatctttataataaatatctcgatcaggtcatcccctggcagaccttt
gatgaaaccataaaagagttaagtcgctttaaacaggagtattcacaggcagcctccgtt
ttagtcggcgatattaaaaccttacttatggatagccaggataagtattttgaagcaacc
caaacagtgtatgaatggtgtggtgttgcgacgcaattgctcgcagcgtatattttgcta
tttgatgagtacaatgagaagaaagcatccgcccagaaagacattctcattaaggtactg
gatgacggcatcacgaagctgaatgaagcgcaaaaatccctgctggtaagctcacaaagt
ttcaacaacgcttccgggaaactgctggcgttagatagccagttaaccaatgatttttca
gaaaaaagcagctatttccagtcacaggtagataaaatcaggaaggaagcatatgccggt
gccgcagccggtgtcgtcgccggtccatttggattaatcatttcctattctattgctgcg
ggcgtagttgaaggaaaactgattccagaattgaagaacaagttaaaatctgtgcagaat
ttctttaccaccctgtctaacacggttaaacaagcgaataaagatatcgatgccgccaaa
ttgaaattaaccaccgaaatagccgccatcggtgagataaaaacggaaactgaaacaacc
agattctacgttgattatgatgatttaatgctttctttgctaaaagaagcggccaaaaaa
atgattaacacctgtaatgagtatcagaaaagacacggtaaaaagacactctttgaggta
cctgaagtctga
              
                            

Download fasta file
RegulonDB