RegulonDB RegulonDB 10.8: Gene Sequence
cvrA gene sequence


Size: 1737        A: 331  T: 497  G: 496  C: 413

Fasta

 

>cvrA E. coli K12. Version NC_000913.3 GI:556503834
ttggatgccacaacaataattagccttttcatcttaggatccatccttgtcaccagcagt
atattacttagttcattttcttcccgtcttggcattcctattctggttatttttctggcg
atcggcatgctggcaggagtcgatggcgtcggcggtatcccgtttgataattaccccttc
gcctacatggtaagtaacctggcactggcgattattttgctcgacggcgggatgcgcact
caggccagttcctttcgtgtggcgttaggaccggcactgtcgctggcgacgctgggcgtg
cttatcacctctggtttaaccggcatgatggcggcgtggctgtttaatcttgatttgatt
gaaggcttattaatcggcgctatcgtcggctctaccgatgctgcagcggtcttttctctg
ctgggtggtaaggggcttaacgaacgtgttggctcgacgctggaaattgaatccggcagt
aatgatccaatggcggtctttctgacgattaccctaattgcgatgatccagcatcatgag
agcaatattagctggatgttcattgtcgatattctgcaacaatttggtctgggcattgta
ataggtcttggcggcggttatttactactgcaaatgatcaaccgcatcgccctgcccgcc
ggattatatccattgctggcattaagtggcggtattctgattttctcattaactactgcg
ctggaaggtagcggtattctggcggtgtatctgtgcggttttctgctgggtaatcgccct
attcgcaaccgctacggcatcctgcaaaatttcgacggcctcgcctggctggcgcaaatc
gccatgttcctggtgctggggctgttggttaacccaagcgatctgctgcctattgccatt
ccggcgctcattttgtccgcatggatgatattcttcgcccgtcccctttcggtatttgct
ggattgctccccttccgcggtttcaatctgcgtgagcgcgtgtttatcagctgggtagga
ttacgcggcgcggtgccaatcatcctggccgtgttcccgatgatggcggggctggagaat
gcacgtctgttctttaatgtcgccttctttgtggttctggtttcactgctcttgcaggga
acatcactctcgtgggcggctaaaaaagccaaagtggtggttccgccagtgggacgtccg
gtgtcacgcgttggcctggatattcatccggaaaatccgtgggagcagtttgtttatcaa
ttgagtgccgataaatggtgcgtgggcgcggcactgcgcgatttgcatatgccaaaagag
acgcgtattgcggcactgtttcgtgataaccagttgcttcatcctaccggcagcacccga
ctgcgcgaaggcgatgtgttgtgtgtaattggtcgggaacgcgatcttccggcgctcggt
aaactgttcagccagtcgccgccggtcgcgctggatcaacgcttctttggtgacttcatt
ctcgaagccagcgccaaatatgctgatgttgcgctgatatatggcctggaagacgggcga
gaatatcgtgataagcagcaaacgctgggtgaaattgtccagcagttgttaggcgcggca
ccggttgtcggtgaccaggtagagtttgccgggatgatctggacggtggccgagaaagaa
gataatgaagtgttgaagattggcgtacgggtggctgaagaggaagctgaatcttaa
              
                            

Download fasta file
RegulonDB