RegulonDB RegulonDB 10.9: Gene Sequence
ldcA gene sequence


Size: 915        A: 199  T: 231  G: 244  C: 241

Fasta

 

>ldcA E. coli K12. Version NC_000913.3 GI:556503834
atgtctctgtttcacttaattgccccatcgggttactgcattaaacagcacgccgcgctg
cgtggtatccagcgccttaccgacgcggggcatcaagtcaataacgtcgaggttattgcc
cgtcgttgtgagcgttttgcgggtacggaaacagagcgtctggaagatctcaattccctt
gccagactgactacccccaacaccatcgtgctggctgtacgcggcggttacggtgccagt
cgtttactggcagatattgactggcaggcactggtggctcgccaacaacatgacccgttg
ctcatttgcggacatagcgattttaccgccattcagtgcggtcttctggcgcatggcaat
gtcatcacctttagcggccccatgctggtagcaaactttggcgcggatgaactgaacgcc
tttaccgagcaccatttctggctggcgttacgcaatgaaaccttcaccattgaatggcaa
ggggaaggcccgacatgtcgggccgaaggcacgttgtggggaggcaatcttgcgatgctg
atttcactgatcggtacaccgtggatgccaaaaattgagaacggtattctggtgctggaa
gatattaacgagcaccctttccgggtcgaacgtatgctgttgcagctctatcatgcggga
attttgccacgtcagaaggcgattattctcggtagctttagcggcagcacgcccaatgat
tatgacgcaggttacaacctggagtcagtgtacgcgtttttgcgttcccgcctgtcgatt
ccactcattaccggcctcgattttggtcatgaacaacgcacggttacgctgccgttgggc
gcacatgccattctgaataacacccgggaaggcactcagttgacgattagcggtcatcct
gttcttaaaatgtaa
              
                            

Download fasta file
RegulonDB