RegulonDB RegulonDB 10.9: Gene Sequence
ycgR gene sequence


Size: 735        A: 188  T: 174  G: 178  C: 195

Fasta

 

>ycgR E. coli K12. Version NC_000913.3 GI:556503834
gtgagtcattaccatgagcagttcctgaaacaaaatccgttagccgtcctgggcgtgtta
cgcgatttgcacaaagccgcaattcctttgcgtctcagttggaatggcgggcagctgatc
agcaaattactggcaataaccccggataaactggtgctggatttcggcagtcaagccgaa
gacaacatcgccgtgctaaaggcacagcacattaccattaccgccgaaactcagggtgcg
aaagtcgagtttactgttgaacaactacagcagagtgaatacttgcagcttccggcattt
attaccgtaccgcctcccaccttatggtttgtacaacgacgccgatatttccgcatctcc
gccccactccatccgccttatttttgccagaccaaactggcggataacagtacgttacgt
ttccgcctgtatgatttgtcgttaggcggcatgggcgcattactggaaacagcaaagcct
gccgaattacaagaaggcatgcgcttcgctcagattgaagtcaacatggggcaatggggt
gtttttcactttgacgcccagttaatctccatcagcgagcgcaaagtgattgatggcaag
aatgaaaccatcaccactccccgtctgagcttccgttttcttaacgtcagcccgacggtg
gagcggcaattacagcggattattttctctctcgagcgagaagcccgggaaaaagcggac
aaagtgcgcgactga
              
                            

Download fasta file
RegulonDB