RegulonDB RegulonDB 10.9: Gene Sequence
ymgE gene sequence


Size: 255        A: 42  T: 77  G: 81  C: 55

Fasta

 

>ymgE E. coli K12. Version NC_000913.3 GI:556503834
atgggaattattgcctggattatttttgacctgatagccggcattatcgccaagctaatc
atgccggggcgtgatggtggtggatttttcctgacctgtattctcgggatagtcggtgcg
gtggtcggcggctggctggcgaccatgtttggcattggcggctccatcagtggttttaat
ctgcacagcttcctggtggcggtggtgggagctattctcgttctgggcatattccgcctc
ctgcgaagagaataa
              
                            

Download fasta file
RegulonDB