RegulonDB RegulonDB 10.9: Gene Sequence
ycgY gene sequence


Size: 441        A: 134  T: 124  G: 102  C: 81

Fasta

 

>ycgY E. coli K12. Version NC_000913.3 GI:556503834
gtgattcagaaaataaatattttagacagtagccagtcaggcgttaaaaatggggcggat
agtgaggcggttttggctgcgcttattgaacatttagaattgatcaatccttctggcaga
ttaagccaaaatacccgttcggcaatgcttcagttacgcgaagaggaatggtctgaattc
tttttttggttgctaaattctctggagtgtctggattatgtgattattaatttaactcca
gaaagcaaaaaaacgttgatgagtgaacaccgtaacaatattcaggtagcaattgatgct
ttatatagccaacgtcggcgtaaatcgccgggtgatgaaagtgaaacacttacccgtaga
aatgacgctatcttcggcaaccacgtatggcaaacatttgcgcaatacttcccgccagga
cttgaaaaaccgtctgtgtag
              
                            

Download fasta file
RegulonDB