RegulonDB RegulonDB 10.9: Gene Sequence
ycgV gene sequence


Size: 2868        A: 782  T: 658  G: 725  C: 703

Fasta

 

>ycgV E. coli K12. Version NC_000913.3 GI:556503834
atgggcatcaaacaacacaatgggaataccaaagcagatcgtctcgctgaattaaaaatc
cgttcgccctcaattcaactgataaaatttggcgctattggtttgaatgcaattatcttt
tcccccctgctgatagctgctgatacaggaagtcaatatggcaccaatattactattaat
gatggtgacagaattacaggagataccgccgatccatcaggaaacctctatggtgtaatg
accccagcaggaaacacgcctggcaatatcaacctgggtaatgatgtcaccgtcaatgtc
aacgacgcctctggatatgcaaaaggaatcattattcagggcaaaaacagctccctgaca
gctaaccgactcacagtagatgttgttggtcaaacctctgccatcggcattaacttaatt
ggtgactatacccatgctgacttaggcacaggcagcaccattaagagtaacgatgacggc
atcattattgggcatagctcaacactaacagccactcaattcaccattgaaaactcgaac
ggtataggcctaaccatcaatgactatggcaccagtgtcgatcttggaagcggaagtaaa
atcacgaccgatggaagtacaggtgtttatatcggtggtctcaacggcaataacgccaat
ggtgctgcgcgttttacggctacagacctgacaatcgatgttcagggctacagcgccatg
gggataaacgtacagaaaaactctgttgtcgatctcggaacaaacagtaccattaaaacc
aatggcgataatgctcacggcctctggagctttggccaggttagcgcgaatgcactcact
gttgatgtaactggagccgcggccaatggcgtcgaagttcgtggtggtacaaccactatc
ggtgcagatagccatatttcttccgcgcagggcggtggcctcgtcaccagtggttcagac
gcgataatcaattttactggcacggcagcgcaacgaaacagcatcttttccggcggttct
tatggtgcctcggcccagacggcaacggctgttgtcaacatgcaaaataccgatattaca
gttgatcgtaatggcagtctggcgctgggtttgtgggctctcagcggcggtagaataacc
ggagacagtttggctatcaccggcgcggcaggagccaggggaatttatgccatgaccaac
agccagatcgacctcacgagcgatctggtcattgatatgagtacacccgaccagatggcc
atcgcaacgcaacatgacgatggttatgccgccagccgcatcaacgcctcgggtcgtatg
cttatcaacggtagcgttctttccaaaggtgggctaatcaatctggatatgcaccctggg
tcggtttggacaggttcctccctcagcgataatgtcaatggcggaaaactggacgttgca
atgaataacagcgtctggaacgtaacaagtaattctaatctcgacacgctggcgctgagc
cattcaactgtcgattttgccagccacgggtcaactgccggcacatttgccacattaaac
gtagagaacctgagcggtaacagtacctttattatgcgtgctgatgttgttggcgagggt
aatggcgttaataataaaggggatttattgaatatcagcgggagtagtgctggtaatcac
gtattggctatccgcaaccagggcagcgaggccacaacgggaaatgaagttctgacagtg
gtaaaaaccactgacggcgcggcctcgttcagcgcgtcttctcaggttgagttgggggga
tatctgtacgatgtgcgtaaaaatggcactaactgggagctttacgcttccgggacagtt
ccggaaccgactcctaatcctgaacccacaccagctcccgctcagcctcccatagtcaac
cccgatcctacgcctgaacccgctcccacgcctaaacccaccacgaccgcagatgctggc
ggcaattatctcaatgtcggttacttattgaactatgttgaaaaccgtacgctgatgcaa
cggatgggtgacctgcgaaatcagagtaaagacggtaatatctggttgcgcagttatggg
ggaagcctggactcctttgccagtggcaaactgagcggctttgacatgggttacagcggt
atccagtttggtggggataaacgtctctctgatgtaatgccgttgtatgtcggtctgtat
attggctcaacacatgcatcgccggactatagcggaggcgacggtaccgcacgttcagac
tacatgggaatgtacgccagttacatggcacaaaacggtttttacagcgatctcgttata
aaagcatcgcgccagaaaaatagtttccacgtactggacagtcagaacaacggcgttaac
gccaacggcactgcgaatggaatgagcatctccctggaagccgggcagaggttcaacctg
tcccctactggttatgggttctatatagagccgcaaacccagcttacatacagccaccag
aatgagatgactatgaaggcgagtaatggcctcaatatacatctgaatcactacgaatcg
ctgctggggcgtgccagcatgatactggggtatgacatcaccgcaggcaacagccagctg
aatgtctatgtgaagactggcgctatccgcgagttttcaggggataccgaatatctgttg
aacaactcccgggagaagtacagtttcaaaggtaatggctggaataacggcgtgggagtc
agtgcacagtataacaaacagcacacattctatctcgaagcggattacacgcagggtaac
ctctttgatcagaagcaagtcaacggaggatatcgcttcagcttttaa
              
                            

Download fasta file
RegulonDB