RegulonDB RegulonDB 10.10: Gene Sequence
ychQ gene sequence


Size: 393        A: 80  T: 126  G: 95  C: 92

Fasta

 

>ychQ E. coli K12. Version NC_000913.3 GI:556503834
atgacaagtttttctacactgcttagtgttcatcttattagtatcgcgctttctgttggg
ctattaaccttacgtttctggctacgttatcagaagcatccacaggcatttgctcgctgg
acgcgcattgtgccgccggttgtcgatacgctgttactgttaagcggcattgcgttgatg
gctaaagcgcacatcctgccattttccgggcaggcacagtggctgactgaaaagctgttt
ggagttatcatttatatcgttttgggttttattgcactcgattatcgtcgtatgcacagt
cagcaggcgcgcattattgccttcccgctggcgttggtggtgctgtacatcatcattaaa
ctcgccaccacaaaagtaccgttactggggtaa
              
                            

Download fasta file
RegulonDB