RegulonDB RegulonDB 10.9: Gene Sequence
ychS gene sequence


Size: 276        A: 40  T: 72  G: 88  C: 76

Fasta

 

>ychS E. coli K12. Version NC_000913.3 GI:556503834
atggtggtgggggaaggattactcagcgctgcgcgcttcgcccttcgggtcgttgcctgc
ggcaacgctctctcgctggcgctcaagtcgaaccttggtcgaagcttctcatccttcccc
gcttgggcagaatatttgattgcggattcgtttgagaattccggggcttttgaaagtgat
ggtggtgggggaaggattactcagcgctgcgcgcttcgcccttcgggtcgttgcctgcgg
caacgctctctcgctgacgctcgagccgaaccttag
              
                            

Download fasta file
RegulonDB