RegulonDB RegulonDB 10.9: Gene Sequence
yciO gene sequence


Size: 621        A: 160  T: 162  G: 156  C: 143

Fasta

 

>yciO E. coli K12. Version NC_000913.3 GI:556503834
atgagccagtttttttatattcatcctgataacccacagcaacgtctgatcaaccaggcg
gtggagatcgtgcgtaaaggcggggtgattgtttatccaactgattccggctatgcgctc
ggctgtaaaattgaagataaaaacgcgatggagcgtatttgtcgtattcgccagctgccg
gacggtcacaactttaccctgatgtgtcgcgatctttctgaactctcgacctattcattt
gttgataacgttgcgtttcgtttaatgaaaaacaacacgccgggcaactataccttcatc
ctgaaggggacgaaggaagtgccacgccgtctgttgcaggaaaaacgcaaaaccatcggt
atgcgtgtgccttctaaccctatcgctcaggcgttacttgaagcattgggcgaaccgatg
ctttccacttcgctaatgctgccaggcagcgaatttaccgaatcggacccggaagaaatt
aaagatcgtctggaaaaacaggtagatttgattattcacggcggctatctcgggcagaaa
ccgacaacggttattgatcttaccgatgatacgccggtcgtggtgcgtgaaggcgtaggt
gatgtgaagcctttcttataa
              
                            

Download fasta file
RegulonDB