RegulonDB RegulonDB 11.1: Gene Sequence
ycjD gene sequence


Size: 354        A: 82  T: 96  G: 99  C: 77

Fasta

 

>ycjD E. coli K12. Version NC_000913.3 GI:556503834
gtgatagataaaattaaatcaaatgcgcgtgatttaagacgcaatctcactttgcaggaa
cgaaagctctggcgatatcttcgcagccgacgttttagtgatttcaaatttcgccgtcaa
catccagtggggagctacattctcgattttgcttgctgctcggcgcgtgtagtcgttgag
ctggatggtgggcagcatgatttagcagttgcctatgattccaggcgcactagctggctt
gagtcgcagggctggaccgtgctgcgtttctggaataacgagattgattgtaatgaggag
acggtgctggagaatattctgcaggaactgaaccgccggtcaccctctccctga
              
                            

Download fasta file
RegulonDB