RegulonDB RegulonDB 10.9: Gene Sequence
ycjN gene sequence


Size: 1293        A: 364  T: 282  G: 341  C: 306

Fasta

 

>ycjN E. coli K12. Version NC_000913.3 GI:556503834
atgattaaatcaaaaatcgtgctgttatcagcactggtttcatgcgccctgatttcaggc
tgtaaagaagaaaataaaacgaatgtatccatcgaatttatgcattcttcggtggagcag
gagcgccaggccgttatcagtaaattgattgcccgttttgaaaaagaaaaccctggcatc
accgttaagcaagtgcccgtggaagaagatgcctataacactaaagtcattactctttca
cgtagcggttcgctgccggaagtgatcgaaaccagccatgactacgccaaagtgatggac
aaagagcagcttatcgatcgcaaagcggttgccacagtcatcagcaacgttggtgaaggc
gcgttttacgatggcgtactgcgtattgtgcgtaccgaagatggtagcgcatggaccggt
gttcctgtcagcgcctggattggcggtatctggtatcgcaaagatgtgctggcaaaagcg
gggcttgaggagccgaaaaactggcaacagctgctggacgttgcacagaaactgaatgac
ccggcgaataaaaaatacggcattgcgctgcctacagcagaaagcgtgttgacggaacaa
tccttctcccagtttgcgttatccaaccaggctaacgtctttaacgccgaaggcaaaatc
acccttgatacaccagagatgatgcaggcactgacctattaccgcgaccttactgccaac
actatgccgggttctaacgacatcatggaagtgaaagacgcctttatgaacggcaccgcg
ccgatggcgatttactccacctatatccttccggctgtgattaaagaaggcgacccgaaa
aacgtcggtttcgtggtgccaaccgagaaaaactctgcggtctacggcatgttgacctcg
ctgaccattaccgccgggcaaaagaccgaagagacggaagcagcagaaaaatttgtcacc
tttatggagcaggcagacaacattgccgactgggtgatgatgtcgccaggtgctgcgctg
ccggtgaataaagcggtggtgactaccgccacctggaaagacaacgacgttattaaggcg
ctgggtgaactaccgaatcagctaatcggtgaactgccaaatattcaggtttttggcgca
gtaggggataaaaactttacccgcatgggtgatgtgacgggttctggcgtggtgagttca
atggtgcataacgtcaccgtgggtaaagccgatctctctactacgctgcaagcgagccag
aaaaaactggatgaactgatcgaacagcactaa
              
                            

Download fasta file
RegulonDB