RegulonDB RegulonDB 10.9: Gene Sequence
ycjO gene sequence


Size: 882        A: 158  T: 251  G: 240  C: 233

Fasta

 

>ycjO E. coli K12. Version NC_000913.3 GI:556503834
atgaacaggcttttttcaggtcgttccgatatgccctttgcgctgctgcttctcgcgccc
agcttattactgctgggcggtctggtggcgtggccgatggtgtcgaatatcgaaatcagt
tttttacgtctgccgctcaatcccaacatcgagtcaacgtttgttggggtgagcaactat
gtgcgtatcctctccgatcccggcttctggcattcgctgtggatgacggtctggtatacc
gcgctggtggtggcgggcagcaccgtgctcgggctggcggtggcgatgtttttcaaccgc
gagttccgcctgcgcaaaaccgcgcgttcgctggtgatcctctcctacgtaacgccgtcc
atttcgctggtgttcgcctggaaatacatgttcaacaacggctacggcattgttaactac
ctcggcgtcgatcttctgcatctctatgagcaggcaccgctgtggttcgataatccgggc
agtagctttgtgctggtggtgctgttcgccatctggcgctacttcccgtatgcctttatc
tcgtttctggcgattttgcagaccatcgacaaatcgctgtacgaagcggcagagatggat
ggcgctaatgcctggcaacggtttcgtatcgtcacgctgcccgcaattatgccggtcctg
gcgacggtggtgacactgcgcaccatctggatgttctacatgttcgcggatgtttatttg
ctgacgaccaaggtcgatattctcggtgtatatctctacaaaaccgcctttgcctttaat
gatttaggaaaagcggcggcgatctcggtggtgctcttcatcattattttcgctgtcatt
ctgctgaccaggaaacgggtgaacctcaatggcaacaaataa
              
                            

Download fasta file
RegulonDB