RegulonDB RegulonDB 10.9: Gene Sequence
ycjP gene sequence


Size: 843        A: 158  T: 240  G: 224  C: 221

Fasta

 

>ycjP E. coli K12. Version NC_000913.3 GI:556503834
atggcaacaaataaacgcacactcagtcgcatcggtttttactgcgggctggcgctgttt
ctcatcatcacgctgtttccattttttgtgatgctgatgacctcgttcaagggcgcgaaa
gaggcgatctcactgcatcctacgctgctgccgcagcagtggacgctggagcattacgtc
gacatttttaacccgatgattttcccgtttgtcgactacttccgtaacagtctggtggtg
tctgtggtttcatccgtggtggcggtattcctcggcattcttggggcttacgcgctttcc
cgcctgcgctttaaaggtcggatgaccatcaacgccagcttttacacggtgtatatgttc
tctggcattttgctggtggtgccgcttttcaaaatcatcaccgcgcttggcatttacgac
actgagatggcgctgatcatcaccatggtgacgcaaactctgcccaccgccgtgtttatg
ctgaaaagctacttcgacaccatccccgatgagatcgaagaagcggcgatgatggatggc
ctcaaccgtctgcaaattatcttccgcatcaccgtgccgttggcgatgtccgggctgata
tccgtgttcgtctactgctttatggtggcgtggaacgactatctgtttgcgtcgattttc
ctctccagcgccagcaatttcaccttaccggtgggcctgaacgcgctgttcagtacgcca
gattacatctggggacggatgatggcggcctcactggtgaccgcattgccggtggtgatt
atgtatgcgctttcggaacgttttattaagagtggtttgaccgccggtggcgtgaagggc
taa
              
                            

Download fasta file
RegulonDB