RegulonDB RegulonDB 10.9: Gene Sequence
ycjQ gene sequence


Size: 1053        A: 236  T: 230  G: 308  C: 279

Fasta

 

>ycjQ E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagttagtagccacagcaccgcgtgttgctgcgctggttgagtatgaagatcgg
gcgattttagctaatgaagtgaagatccgcgtgcgtttcggcgcaccgaaacacggaacg
gaagtggtcgacttccgcgccgccagcccgtttattgatgaagactttaacggcgaatgg
cagatgttcactccgcgtccggcagatgcgccgcgcggcattgagtttggcaaattccag
cttggcaacatggtggttggcgacattatcgagtgcggcagcgacgttaccgactacgcg
gtgggcgacagcgtatgcggctacggcccgctctccgagacggtcatcattaacgcagtg
aataactacaagctgcgcaaaatgccgcaaggcagctcctggaaaaacgccgtctgctac
gacccggcgcagtttgccatgagcggcgtgcgcgatgccaacgtgcgcgtaggggatttt
gtggtggtggtagggcttggcgcaatcggtcaaattgccatccaactggctaaacgcgct
ggcgcttctgtggtgattggcgtcgatcctatcgcccatcgctgtgatattgcccgtcgc
cacggcgcggatttctgccttaaccccatcggcactgatgtaggtaaagagatcaaaacg
ctgaccggcaagcagggtgccgatgtgattatcgaaaccagcggctacgccgacgcgctg
caatcggcgctccgcggtctggcttatggcggcaccatctcctatgtcgcgtttgccaag
ccgtttgccgaaggttttaacctcggacgcgaagcgcatttcaataacgccaaaattgtc
ttctctcgcgcgtgcagcgaaccgaacccggattatccgcgctggagccgcaagcgtatt
gaagaaacctgttgggaactgctgatgaacggttatctcaattgcgaagatttaatcgac
ccggtggtgacctttgccaatagcccggaaagctatatgcagtatgtcgaccagcatccg
gaacagagcatcaaaatgggcgttacgttttaa
              
                            

Download fasta file
RegulonDB