RegulonDB RegulonDB 10.9: Gene Sequence
ycjR gene sequence


Size: 789        A: 191  T: 175  G: 221  C: 202

Fasta

 

>ycjR E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatcggcacacagaatcaggcgttctttccggaaaacattctggagaaatttcgt
tatatcaaagagatgggcttcgatggttttgagattgacggcaaactgctggttaacaac
atcgaagaagtcaaagcggcgatcaaagaaaccggtttaccggtgaccaccgcctgcggt
ggctatgacggatggattggcgactttatcgaagagcgtcgtcttaatggcttaaagcag
atcgagcgcattctcgaagcgctggcagaagtgggcggtaaaggcatcgtcgttccggct
gcgtggggcatgtttaccttccgcttaccgccgatgacctcgccgcgtagcctggacggc
gaccgcaaaatggtgagtgattccctgcgcgtactggaacaggtcgccgcgcgtaccgga
accgtggtgtatctcgaaccgttaaaccgctatcaggatcatatgatcaacaccctcgcc
gatgcccgccgttacatcgtcgaaaacgatcttaaacatgtacagattatcggcgatttc
tatcacatgaatatcgaagaagataacctggcgcaggcgctgcatgacaaccgcgacctg
ctcggtcatgtgcatattgcggataaccatcgctaccagccgggcagcggcaccctggat
ttccacgcgctgtttgaacagctgcgcgcggataactatcagggctatgtagtgtacgaa
gggcgtatccgggcggaagatcctgcccaggcgtaccgtgattcgttggcctggttgcgt
acctgctaa
              
                            

Download fasta file
RegulonDB