RegulonDB RegulonDB 10.9: Gene Sequence
ycjT gene sequence


Size: 2268        A: 537  T: 512  G: 651  C: 568

Fasta

 

>ycjT E. coli K12. Version NC_000913.3 GI:556503834
atgaccaggccagtaacgttatcagaaccccatttcagccagcataccctgaacaagtat
gcatcgctgatggcgcaggggaacggctatcttgggcttcgcgccagccatgaagaagat
tacacgcgccagacgcgagggatgtatctggcggggctgtatcatcgggcgggaaaaggt
gaaatcaacgaactggtgaacctgcctgatgtcgtggggatggagattgccataaatggt
gaggttttctcgttatcccacgaagcctggcagcgtgagcttgactttgccagtggcgaa
ttacgccgcaatgttgtctggcgtaccagcaacggctcaggttacaccatcgccagccgt
cgctttgtttcggcagaccaactgccgctcattgcgctggaaatcactattacgccactg
gacgccgacgcgtcagtgctgatttcaacaggcattgacgccacgcaaaccaatcacggt
cgccaacatctcgacgaaacccaggtgcgggtgtttggtcagcatctgatgcaggggagc
tacaccacccaggatggacgcagtgatgtggccatcagctgttgctgtaaggtgagcggt
gatgtgcagcaatgctataccgccaaagagcgccgtttactgcaacataccagtgcgcag
cttcatgcaggcgagacaatgacgttgcaaaaactggtgtggatcgactggcgggatgac
aggcaagctgctttagacgagtggggcagcgcgtcgcttcgccagcttgaaatgtgcgcg
cagcagagttacgaccaacttcttgcagcatcaacagaaaactggcgtcaatggtggcag
aaacgtcgtatcacggtaaatggcggcgaagcgcacgatcagcaagcgttagattatgcg
ctttatcatctgcgcatcatgacgcctgcccacgacgagcgcagcagcattgcggcaaaa
ggcttaaccggcgaaggctacaaaggccacgttttctgggatacagaagtatttttgtta
ccgtttcatctgtttagcgatccgacggttgcccgaagtttactgcgttatcgctggcac
aacttgccaggcgcgcaggagaaagcgcgacgcaacggctggcagggcgcgctatttccg
tgggaaagcgcgcgcagcggcgaagaagagacgccggaatttgccgccattaacattcgc
accgggctgcggcaaaaagtggcctcggcgcaggcggaacatcatctggtggccgatatc
gcctgggcggttattcaatactggcagaccacgggggatgaaagtttcattgcgcatgaa
ggcatggcgctacttctggagacggcaaagttctggattagccgcgcggtgagagttaac
gatcgtctggaaattcatgatgttattgggccagacgaatataccgaacatgtcaataat
aatgcatacaccagctatatggcccgctacaacgttcaacaggcgctgaatattgcccgc
cagttcggctgtagcgacgatgcgtttatccatcgcgccgaaatgttcctcaaagagcta
tggatgccagaaattcagcccgacggcgttttgccgcaggatgattcgtttatggctaag
ccggcgattaatctggcgaaatacaaagcggcggcggggaagcaaaccatactgctggat
tattcacgcgcagaagtgaacgagatgcagatcctcaaacaagctgatgtggtgatgctc
aattacatgctgccggagcagttctcagcggcatcgtgtcttgccaatctgcaattttat
gaaccgcgcactattcacgactcgtcattaagtaaagcaatccacggcattgttgccgca
cgctgtggcctgctgacccaaagttatcagttctggcgcgaggggactgaaatcgatctt
ggtgctgatccgcatagttgtgatgatggtatccatgctgccgcaactggcgctatctgg
ctgggggcgattcagggttttgccggggtgagcgtgcgtgacggtgaattgcatctcaat
ccggcgttacctgagcagtggcaacagttgtctttccctctgttctggcagggctgcgaa
ttacaggtcactcttgacgcgcagcgtattgcgattcgaacttctgcgcccgtttcactg
cgtttgaacggtcagcttataaccgtggctgaagaatctgttttctgtttgggtgatttt
attttgcccttcaatgggaccgctaccaaacatcaggaggatgaatga
              
                            

Download fasta file
RegulonDB