RegulonDB RegulonDB 10.9: Gene Sequence
ycjU gene sequence


Size: 660        A: 137  T: 150  G: 192  C: 181

Fasta

 

>ycjU E. coli K12. Version NC_000913.3 GI:556503834
atgaaactgcaaggggtaattttcgatctggatggtgtaatcaccgataccgcgcatctg
catttccaggcgtggcagcagattgccgctgaaattggcatcagcattgatgcgcagttt
aacgaatccctaaaagggatcagccgcgatgagtctctgcggcgcattctgcaacacggg
ggcaaagagggcgactttaactcgcaggagagggcgcaactggcgtatcgcaaaaatctg
ctctatgtccactcactacgcgagttgacggtcaacgctgttctacccggcattcgctct
ttgctggcagatctccgtgcacagcagatctcggttgggctggcttctgtctccctgaat
gcgccgacgattttagcggcgctggagctgcgcgagtttttcaccttctgcgcggatgct
tcccaacttaaaaactcgaaaccggacccggaaatctttctcgccgcctgtgcagggctg
ggcgtgccgccgcaggcatgtatcggcattgaagatgcgcaggcgggcattgacgccatt
aacgccagcggtatgcgctcggtggggatcggcgcgggcttaaccggggcgcaattactg
ttgccttcaacggaatcactcacctggccgcggttatcggccttctggcaaaacgtatag
              
                            

Download fasta file
RegulonDB