RegulonDB RegulonDB 10.9: Gene Sequence
ycjV gene sequence


Size: 969        A: 265  T: 214  G: 271  C: 219

Fasta

 

>ycjV E. coli K12. Version NC_000913.3 GI:556503834
atggctcagctttcgttacaacatattcaaaaaatctacgataaccaggtgcatgtggtg
aaggacttcaacctggaaattgccgataaagagttcatcgtgtttgtcggcccgtcgggc
tgcggtaagtcgaccaccctgcgcatgattgccgggcttgaggagatcagcggcggcgat
ctgttgatcgacggcaaacgaatgaatgacgttccagccaaagcacgcaatatagcgatg
gtgttccagaactacgcgttgtatccgcatatgacggtttacgacaacatggcgtttggt
ctgaagatgcaaaaaatcgccaaagaggtgattgatgagcgggtgaactgggcggcgcaa
attctcggcctgcgtgagtacctgaaacgtaagccgggggcgctttccggcgggcaacgt
cagcgagtggcgcttgggcgggcgattgtacgcgaagcgggcgtgtttttaatggatgaa
ccgctctctaaccttgatgccaagctgcgcgtgcaaatgcgcgcagagatcagcaagctg
catcagaaactgaacaccaccatgatctacgtgacccacgatcagaccgaagcgatgacc
atggcgacgcggattgtgattatgaaagacgggattgttcagcaagtaggtgcgccgaaa
accgtttataaccaacccgcgaatatgtttgtttccggatttattggatcaccagcgatg
aattttattcgcggcacgatcgatggcgataaattcgttacggaaacgcttaaattaacc
attcccgaagagaaattagcggttctgaaaacacaggaaagtttgcataagcccatcgtg
atgggaatacgaccggaagatattcatccggacgcgcaagaggaaaataacatttccgcc
aaaattagcgtggcagaattaaccggtgcggaatttatgctctacaccacggttgggggc
acgagttag
              
                            

Download fasta file
RegulonDB