RegulonDB RegulonDB 10.9: Gene Sequence
ompG gene sequence


Size: 906        A: 228  T: 226  G: 259  C: 193

Fasta

 

>ompG E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagttattaccctgtaccgcactggtgatgtgtgcgggaatggcctgcgcacag
gccgaggaaaggaacgactggcactttaatatcggcgcgatgtacgaaatagaaaacgtc
gagggttatggcgaagatatggatgggctggcggagccttcagtctattttaatgccgcc
aacgggccgtggagaattgctctggcctattatcaggaagggccggtagattatagcgcg
ggtaaacgtggaacgtggtttgatcgcccggagctggaggtgcattatcagttcctcgaa
aacgatgatttcagtttcggcctgaccggcggtttccgtaattatggttatcactacgtt
gatgaaccgggtaaagacacggcgaatatgcagcgctggaaaatcgcgccagactgggat
gtgaaactgactgacgatttacgtttcaacggttggttgtcgatgtataaatttgccaac
gatctgaacactaccggttacgctgatacccgtgtcgaaacggaaacaggtctgcaatat
accttcaacgaaacggttgccttgcgagtgaactattatctcgagcgcggcttcaatatg
gacgacagccgcaataacggtgagttttccacgcaagaaattcgcgcctatttgccgctg
acgctcggcaaccactcggtgacgccgtatacgcgcattgggctggatcgctggagtaac
tgggactggcaggatgatattgaacgtgaaggccatgattttaaccgtgtaggtttattt
tacggttatgatttccagaacggactttccgtttcgctggaatacgcgtttgagtggcag
gatcacgacgaaggcgacagtgataaattccattatgcaggtgtcggcgtaaattactcg
ttctga
              
                            

Download fasta file
RegulonDB