RegulonDB RegulonDB 10.9: Gene Sequence
ycjW gene sequence


Size: 999        A: 277  T: 268  G: 238  C: 216

Fasta

 

>ycjW E. coli K12. Version NC_000913.3 GI:556503834
atgtcccctactatttatgatattgccagggttgcaggcgtatcaaaatccaccgtatca
cgcgtgctgaataagcaaactaatatctccccggaagcgcgcgaaaaagtgttacgggcc
attgaagaattacagtatcagccaaacaagctggcccgcgcgctgacctcttcgggtttt
gatgccattatggtgatttctacccgttcgaccaaaactacggcgggtaatccgtttttc
tctgaagttttgcatgccatcaccgccaaagctgaagaagaaggtttcgacgtgatatta
caaacgtcgcacaatccggcagaagatctgcaaaaatgcgaaagcaaaattaagcagaaa
atgattaaaggcattattatgctcagttcgccagcggatgagtcattttttgcccaactc
gataaatatgatattccggtggtggtgattggcaaagttgaaggtcaatatgcccatgtt
tattctgtcgataccgataattttggcgacagcattgcgttgaccgatgcattaattgaa
agtgggcatcaaaatattgcctgcctgcatgctccgcttgatgtccatgtttcggttgat
cgcgttaatggttataagcagagcctggctgcgcataatattgcagtgcgtgatgaatgg
attgttgatggcggttatacccatgaaactgcattaaaagcagcacggcaattattaagc
cagtcaccgttgcctgaggcggtgtttgccactgacagcctgaaattaatgagcatttat
cgtgcggcagcagagaaaaatattgctattccgcagcagttagcggtggtgggttatagc
aatgaaacgctgtcatttattttaacgcctgcaccgggcggcatcgatgttccgacgcag
gagttaggtcaacaaagctgcgagttattattccgcttaatttctggaaaaccgtcacca
cagaatattaccgttgccacgcatatgacgctgaaataa
              
                            

Download fasta file
RegulonDB