RegulonDB RegulonDB 10.9: Gene Sequence
ycjX gene sequence


Size: 1398        A: 304  T: 333  G: 404  C: 357

Fasta

 

>ycjX E. coli K12. Version NC_000913.3 GI:556503834
atgaagcgacttaaaaatgaactcaatgcgctggtgaatcggggtgtcgacagacatctg
cgcctcgctgtaaccggacttagccgcagcggcaaaacagcgtttatcaccgcgatggtt
aatcagttgcttaatattcacgccggagcacgtttgccgctgttaagtgcggtgcgtgaa
gagcgcctgctgggcgtgaaacgcattccccagcgtgactttggcattccgcgcttcacc
tatgacgaagggctggcgcagttatatggcgatccacccgcctggccaacgccaacgcgc
ggcgtcagtgaaatccgcctggcgctacgttttaaatcgaatgattcgctgctacgccac
tttaaggatacctccacgctgtatctggaaattgtggattatcccggcgaatggttgctc
gacctgccgatgctggcgcaggactatttaagctggtcgcgccagatgacgggcttactc
aatggtcagcgcggagaatggtcggcgaaatggcgaatgatgagcgaagggctggacccg
ctagcgcctgccgacgaaaaccggctggcggacattgccgccgcgtggaccgattatctc
caccactgtaaagagcaggggctgcactttattcagcctgggcgctttgtcttgccggga
gatatggcaggtgcgcccgcgctgcaattcttcccgtggccggatgtcgatacctggggc
gagtccaaactggcgcaggccgataagcataccaatgccggaatgctgcgcgagcgcttt
aattattactgcgagaaggtggtgaaggggttctataagaatcattttctgcgctttgac
cgccagattgtgctggtggattgcctgcaacctctcaacagtgggccacaggcatttaat
gatatgcgtctggcactgacgcagctgatgcaaagttttcactacgggcagcgtaccctg
ttccggcgtttgttttcgccggttatcgataagctattgtttgctgccactaaagcggac
catgtgaccatcgatcagcacgctaatatggtttcattactgcaacaactgattcaggat
gcctggcaaaatgcggcgttcgaagggatcagcatggactgcctggggctggcgtcagtt
caggcgaccaccagcggcattattgatgttaacggtgagaaaatcccggcgctgcgtggt
aatcgacttagcgatggcgcaccgctcactgtttatcctggcgaagttcccgcacgtttg
cctggtcaggcgttctgggataagcaaggcttccagtttgaggcatttcgtccgcaggtg
atggatgtcgacaaaccactaccgcatattcgtcttgatgctgcgctggaatttttaata
ggagataaattgcgatga
              
                            

Download fasta file
RegulonDB