RegulonDB RegulonDB 10.9: Gene Sequence
tpx gene sequence


Size: 507        A: 119  T: 128  G: 126  C: 134

Fasta

 

>tpx E. coli K12. Version NC_000913.3 GI:556503834
atgtcacaaaccgttcatttccagggcaacccggttacagtcgccaattccatcccgcag
gcgggtagcaaagcgcagacttttactctcgtggcaaaagatctgtctgacgtcaccctc
ggtcagtttgcgggtaaacgcaaagtgctgaacattttcccgagtattgataccggtgtt
tgcgccgcatcagtacgtaagtttaaccaactggcaactgagatcgacaacaccgttgtg
ctgtgtatctctgccgatctgccgttcgcccagtctcgtttctgcggcgcagaaggtctg
aacaacgttatcaccctctccactttccgtaacgctgaatttctgcaagcttacggtgtg
gcaattgctgatggcccactgaaaggtctggcagcgcgtgccgttgtggttattgacgaa
aatgacaatgtgattttcagccagctggtggatgaaatcaccaccgagccggattacgaa
gcagctctggctgtactgaaagcataa
              
                            

Download fasta file
RegulonDB