RegulonDB RegulonDB 10.9: Gene Sequence
ynaI gene sequence


Size: 1032        A: 268  T: 318  G: 230  C: 216

Fasta

 

>ynaI E. coli K12. Version NC_000913.3 GI:556503834
atgatcgctgaactgtttacaaataatgcgcttaatctggtcattattttcggtagctgc
gcagcattgattctgatgagcttttggtttcgccgtggaaatcgtaaaagaaaaggattt
ttattccatgcggtgcaatttttaatctacaccataattatcagtgctgttggtagcatt
attaattatgttatagaaaactataaactcaaatttatcaccccaggcgttatcgatttt
atctgtacgtccctgattgcggttattctgacgattaagctatttctgctgattaatcag
tttgaaaaacagcagattaaaaaaggtcgcgatatcaccagtgcgcggattatgtcgcgt
atcatcaaaatcaccattattgtggtgcttgttctgctttatggcgaacatttcggcatg
agcctttctggcttgctgacctttggtggtattggtggtctggctgtcggtatggccggt
aaagatattctgagtaacttcttttccgggattatgctctatttcgaccgtcctttcagt
attggcgactggatccgttcaccggacagaaatatcgaaggtacagtagcggaaattggc
tggcgaattaccaaaattacgacctttgataatcgtccattgtacgtaccgaactcgctg
ttttcgtcgatcagcgtagaaaacccaggacgaatgaccaaccgccgcattaccacgacc
attggtttacgttatgaggatgcggcaaaagtgggcgttattgtcgaagctgtacgtgag
atgctgaaaaatcacccggccatcgaccagcgacaaaccttactggtttatttcaaccag
tttgctgactcttcattgaatattatggtttattgctttaccaaaaccacggtatgggct
gaatggcttgctgcacagcaagacgtttatttgaagattatcgatattgtacagtcacac
ggcgcggactttgccttccccagccagacgctgtatatggataacattacaccgccggaa
cagggtcgctaa
              
                            

Download fasta file
RegulonDB