RegulonDB RegulonDB 10.9: Gene Sequence
abgB gene sequence


Size: 1446        A: 365  T: 321  G: 368  C: 392

Fasta

 

>abgB E. coli K12. Version NC_000913.3 GI:556503834
atgcaggaaatctatcgttttatcgacgatgcgattgaagccgatcgccaacgttatacc
gatattgccgatcaaatctgggatcatccagaaacacgttttgaagagttctggtcagcg
gagcatctggcttcggcgctggaatctgcaggcttcaccgttacccgcaacgtaggcaat
atcccaaatgcctttattgcttcgtttggtcaaggcaaaccggttatcgccctgctggga
gaatatgacgccctggcaggtttaagtcagcaagcaggttgcgcgcaacctacatccgtg
acgcccggtgaaaatggtcacggttgcggacacaatttgctgggaaccgccgcctttgcc
gctgcaatagccgtcaagaaatggctggaacaatatgggcaaggcggcacggtgcgcttt
tatggttgtcctggcgaagaaggcggctcgggtaaaacgttcatggttcgcgagggggta
tttgatgatgtggatgcggcactcacctggcacccggaagcctttgccggtatgttcaat
acccgcacgctggcaaacattcaggcatcatggcgctttaaagggatcgcagcacatgcc
gcgaattcccctcatttgggacgcagcgcccttgatgccgtaacgttgatgaccactggc
accaacttcctcaacgaacatattattgaaaaagcgcgcgtacactatgccatcacaaat
agcggcgggatctcgcccaacgtggtccaggcgcaggcagaagtgctttatcttatccgc
gcccccgaaatgaccgacgtgcagcatatttatgatcgggtcgccaaaatcgccgaaggt
gcggcattgatgaccgaaaccacggttgaatgccgcttcgacaaagcctgttccagttat
ctcccgaatcgcaccttagaaaatgccatgtaccaggccctatcccattttggtaccccg
gaatggaactccgaagaactggcttttgcgaaacaaattcaggctacgctcacctccaac
gatcggcaaaacagtctgaataatatcgccgcaaccggtggcgaaaacggcaaggttttt
gcactacgtcatcgtgaaacggtactggcgaatgaagtcgctccatatgccgccaccgat
aacgtgcttgcggcatcgactgatgtcggcgacgtcagttggaaactgcctgttgcccag
tgtttcagcccctgttttgccgtcggtacaccgctacatacgtggcaactggttagccag
gggcgaacatctattgctcataaaggaatgctgctggcggcgaaaactatggcagcaacc
acagtcaatctcttccttgattcagggctattgcaagaatgccaacaagagcatcagcaa
gtaacggacacgcaaccgtatcactgccctatcccgaaaaacgtgacaccgtcaccttta
aaataa
              
                            

Download fasta file
RegulonDB