RegulonDB RegulonDB 10.9: Gene Sequence
abgA gene sequence


Size: 1311        A: 283  T: 304  G: 383  C: 341

Fasta

 

>abgA E. coli K12. Version NC_000913.3 GI:556503834
atggagtctttgaatcaatttgttaattcgcttgccccaaaattatcgcactggcgacgt
gattttcatcactatgcagagtctggctgggtggaattccgcactgccacccttgttgcg
gaagaattgcaccagctcggctattcactggcgctgggtcgcgaagtagttaatgaaagt
agccggatgggattacctgatgaattcactctacaacgcgaattcgagcgcgctcgtcaa
cagggtgcgctagcacaatggattgcggcttttgaaggtggtttcactggtatcgtcgcc
accctggataccggtcgccccggtccggtgatggctttccgtgtcgatatggacgcgctg
gatctcagtgaagagcaggatgtcagccatcgcccctaccgcgacggttttgcgtcatgt
aacgccggaatgatgcatgcctgtggtcatgatggacataccgccattgggcttgggctg
gcgcatacccttaaacagttcgagtccggactacatggcgtcatcaaactgatttttcag
cctgcagaggaaggtacgcgtggcgcgcgggcgatggtcgatgcaggtgtcgtagatgat
gttgattattttactgccgtgcacattggcactggcgtacctgcgggcaccgtggtgtgc
ggcagtgataattttatggcaaccaccaaatttgacgcgcacttcaccggtaccgccgct
cacgcaggcgcaaaaccagaagacggtcacaatgccttgttggcggcagcacaagccact
cttgcactgcatgcaatcgccccgcacagcgaaggagcttccagagtaaacgtgggcgtt
atgcaggcaggaagcggtcgtaacgttgttcctgcctcggcgttgctgaaagtggaaaca
cgcggggccagcgacgtcattaatcaatatgtttttgaccgtgcacaacaagcgattcag
ggcgcagcaaccatgtatggtgtcggcgttgaaactcgtctgatgggtgcagctaccgcc
agttctccttcgccgcaatgggtcgcatggttgcaaagtcaggcggctcaggtcgcgggg
gtcaatcaggccattgaacgtgttgaagcgcctgcgggttccgaagatgccacattaatg
atggcccgcgtgcagcaacatcaagggcaagcctcctacgtggtgtttggcacacagctg
gcggcaggtcatcacaacgaaaaattcgattttgacgagcaggttctcgctattgccgtc
gaaacgctggcgcgcaccgcgctcaattttccctggacgcgaggtatctga
              
                            

Download fasta file
RegulonDB