RegulonDB RegulonDB 10.9: Gene Sequence
smrA gene sequence


Size: 564        A: 134  T: 124  G: 162  C: 144

Fasta

 

>smrA E. coli K12. Version NC_000913.3 GI:556503834
atgaaccttgacgacaaatcgctgtttcttgacgccatggaagatgtccagccgctgaaa
cgtgctaccgatgtccactggcatccaacgcgtaaccaacgtgcgccgcagcgtatcgac
acgctgcagcttgataatttcctcaccaccggatttctcgacatcatcccactaagtcag
ccgctggagtttcggcgggaagggttgcaacatggggtgctggataagctgcgcagtggt
aaatatccgcaacaggcgagcctgaatcttttgcgccagccggtggaagagtgccgcaaa
atggtgttcagttttattcaacaagccctggcggatggtttgcgtaacgtgctgattatt
catggtaaagggcgggatgataaatcgcatgccaatattgtccgcagctatgtggcgcgc
tggctgaccgaatttgatgatgttcaggcatattgcaccgcgctaccgcatcatggcggc
agcggggcgtgttacgtcgcactacgtaaaacggcgcaggcgaagcaagaaaactgggag
cgccacgctaagcgcagtcgttga
              
                            

Download fasta file
RegulonDB