RegulonDB RegulonDB 10.9: Gene Sequence
dgcM gene sequence


Size: 1233        A: 331  T: 314  G: 292  C: 296

Fasta

 

>dgcM E. coli K12. Version NC_000913.3 GI:556503834
atgattacgcacaacttcaataccctggacttactcaccagtcctgtctggatcgtttcg
ccctttgaggaacagttaatttatgccaatagcgcggcgaaactgttgatgcaagacctc
acgtttagtcagctacgaaccggaccctattccgtctcctcacaaaaagaactgccgaaa
tacctctccgatctgcaaaaccaacacgatattatcgaaatcctcactgttcagcgtaaa
gaagaggaaacagcattgagctgtcggcttgttttgcgaaagctgacagaaacagaaccg
gtgattattttcgaaggtatcgaagcgccggcaacgctgggtttaaaagccagtcgctcg
gcaaattatcagcgcaaaaaacaaggtttttatgcgcgcttttttctgactaactctgca
ccaatgttgttgattgacccgtcacgagatggacaaatcgtcgatgctaacctcgccgcg
ctcaatttctatggttataaccatgaaacgatgtgccagaaacatacctgggaaataaat
atgctcgggcgtcgcgtcatgcctatcatgcatgaaatctcgcatttacccggtggtcat
aaacctttgaattttgttcataaactggcggatggttcgactcgtcatgtgcagacctat
gccggaccgattgaaatttatggcgacaagctcatgttatgtattgtgcatgatattact
gagcaaaaacggctggaggagcagctggaacatgctgctcaccatgacgcgatgaccgga
ttactgaatcggcgacagttttatcacattacggaaccaggccaaatgcagcatctcgcc
atcgctcaggattacagcttgttgctcatcgacaccgatcgttttaaacacattaacgat
ctctatgggcattctaaaggtgatgaggtgttatgcgccctcgcccgcaccctcgaaagt
tgcgctcgcaaaggcgatttggtgtttcgttggggaggcgaagagtttgtcttattgcta
ccaagaaccccactggataccgcgctttcgctggctgaaactatccgcgtaagcgtggca
aaagtgagtatttcgggcttaccacgctttaccgtcagcattggtgtggcgcatcacgaa
ggaaatgaaagcatcgatgaactgtttaaacgcgttgatgatgctttgtatcgggcgaaa
aatgatggacgcaaccgcgtgctggcggcataa
              
                            

Download fasta file
RegulonDB