RegulonDB RegulonDB 10.9: Gene Sequence
zntB gene sequence


Size: 984        A: 214  T: 259  G: 290  C: 221

Fasta

 

>zntB E. coli K12. Version NC_000913.3 GI:556503834
gtggaagcgattaagggatcggacgttaatgtcccggatgcagtatttgcctggatgctg
gatggtagaggcggcgttaaaccgctggaaaatacagatgtgattgatgaagcgcatccc
tgttggctccaccttaattatgtacaccatgatagcgcccaatggctggcgacaacaccg
ctgcttcccaataacgtacgtgatgcgctggcgggcgagagcacgcgtccccgagtcagc
cgtctcggtgaaggcacgctgattacattgcgctgtataaacggcagcaccgatgaacgc
cccgatcaactggtcgccatgcgtgtatatatggacgggcggttaattgtttcgacccga
caacgcaaagtgctggcgctggacgatgtggtgagcgatctggaagagggcacgggtccg
accgattgcgggggatggctggtggatgtgtgcgatgcgttgaccgatcattccagtgaa
tttatcgagcagctgcacgataaaattatcgaccttgaagataatctccttgatcagcaa
attccaccgcgtggattcctggctctgctgcgcaaacaattaattgtgatgcgtcgctat
atggcaccgcaacgtgatgtttatgctcgtcttgccagtgaacgtttgccgtggatgagc
gatgaccaacgccgtcggatgcaggatattgccgatcgccttgggcgcggccttgacgaa
atcgacgcctgtatagcacggactggcgtgatggcggatgaaatcgctcaggtgatgcag
gaaaatttagctcgtcgtacctatacaatgtcgttgatggcaatggtctttttacccagt
acctttctgaccgggttatttggcgtcaaccttggtgggatccctggcggcgggtggcaa
ttcggattttcaattttttgtattctgttagttgttcttattggtggtgttgctttatgg
ttgcatcgtagtaaatggttgtaa
              
                            

Download fasta file
RegulonDB