RegulonDB RegulonDB 10.8: Gene Sequence
racR gene sequence


Size: 477        A: 163  T: 114  G: 101  C: 99

Fasta

 

>racR E. coli K12. Version NC_000913.3 GI:556503834
atgcttagtggtaaagacttaggccgagcgatagagcaggccattaacaaaaaaatcgca
tcgggatccgtcaaatcaaaggcggaggtcgcacgccactttaaagtccaaccaccatca
atttatgactggattaagaaaggctctataagtaaagataaacttccagaattatggcgt
ttcttttctgatgttgttggtccagagcattgggggcttaacgaataccccataccaacc
cccaccaattcagatacaaaaagtgaacttttagatataaacaacctttatcaagcagcc
tctgatgaaataagagcgattgtagctttcctgttatctggaaatgctacagaaccagat
tgggttgaccacgatgttcgcgcctacatagcagcgatggaaatgaaagtgggtaagtat
ctgaaagctcttgaatctgaacggaaaagccagaacatcacaaaaactggaacttaa
              
                            

Download fasta file
RegulonDB