RegulonDB RegulonDB 11.0: Gene Sequence
ydaS gene sequence


Size: 297        A: 89  T: 79  G: 72  C: 57

Fasta

 

>ydaS E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaagagaactattcattcaagcaagcttgtgctgttgtcggtgggcaatcagca
atggctaggcttttaggtgtatcacctccaagcgtaaatcaatggatcaaaggggtacgt
caattgcctgccgagagatgtccagcaattgaacgtgcaacaagaggtgaggttctgtgc
gaagaacttcgtcctgatattgactggtcatatttacgacgttcggcatgttgttcgcag
aatatgtcagtgaagcaactaaatgacagtaacaaatcctcatttgatcatacctga
              
                            

Download fasta file
RegulonDB