RegulonDB RegulonDB 10.9: Gene Sequence
ydaW gene sequence


Size: 561        A: 169  T: 118  G: 145  C: 129

Fasta

 

>ydaW E. coli K12. Version NC_000913.3 GI:556503834
atggagactgtttttgacgcactgaaagcaatgggaaaagccacatccatagaacttgct
gcgcgacttgatatcagtcgtgaagaagtgctgaacgaactatgggaactgaaaaaggct
ggttttgttgataaaagcgcgtacacctggcgtgtggctgataacaatgttcagcaggaa
cagccagcgcaggcagaactgccggaagaaatcaccacagcaacagtagcgaaaatctca
gagtgcgatttaaccgcgacgattgaacaacgaggaccacaaacggctgatgagctggct
acattgtttggtaccacatcacgcaaagtggcttcaacgctggcaatggcaatcagcaaa
ggtcgtctgattcgcgtaaatcagggcggtaaatttcgttactgcataccgggcgataat
ttaccagcagagccgaaagcagcatcggtatctccgctctggttatctgcatcgtcgtct
gcctgtcatggggtgttaatcattaccgtgataacgccatcgcctacaaagaacagcgcg
acaaaaatgccagagaactga
              
                            

Download fasta file
RegulonDB