RegulonDB RegulonDB 10.9: Gene Sequence
ynaK gene sequence


Size: 264        A: 76  T: 61  G: 74  C: 53

Fasta

 

>ynaK E. coli K12. Version NC_000913.3 GI:556503834
atgagcgagaaattaaagatagtctatcgcccattacaagaattgtcaccgtatgcgcac
aacgccaggacgcacagtactgagcaggtggcacaactggtagaaagtattaagcaattc
ggctggactaatccggtgctgattgacgaaaagggcgaaattattgcgggtcacggtcgt
gttatggcggctgaaatgctcaaaatggattctgttccggtcattgttctgtctggcctg
acggatgagcagaagcagcgataa
              
                            

Download fasta file
RegulonDB