RegulonDB RegulonDB 10.9: Gene Sequence
ydaY gene sequence


Size: 360        A: 106  T: 84  G: 102  C: 68

Fasta

 

>ydaY E. coli K12. Version NC_000913.3 GI:556503834
atgagcagaagcagcgataacgatcagtatcgctcccgtaatgcattaatccgtcgccac
attgagaaaatggatgccagtttgcacgtcggaacgaaggagtttgatatttcaaaggtt
tccgaggtggattctgttgatgatttactcattgataatgccgctcgttatctgctgaaa
gactggaaaggggttggtgaactggttaatggtgttgaggttgcactggaatatacggca
gaacgagggatcgcgctgcttaagcagaatccagagttgtactggcagatccttgcagaa
gcagccagcatcgcccagggtaaagagcagcagaagcaggatacgataaaaaagccatag
              
                            

Download fasta file
RegulonDB