RegulonDB RegulonDB 10.9: Gene Sequence
ynaA gene sequence


Size: 1029        A: 314  T: 233  G: 269  C: 213

Fasta

 

>ynaA E. coli K12. Version NC_000913.3 GI:556503834
atggcagagcaaacctcgcgtctcgcaataattattgatagcactggagcgaaaaataat
gctgacaatctgacctcctcattagtcaaaatgacgcaggctggggaaactgctgcaaat
agcgcagggaaagtgactaaggcaacagaagatgagaagaacgcgctcgcaaaattaaaa
gcagctattgatccagttggtgccgcaattgatactgtcggtcgacgctattctgaatta
aagaaatttttcgataaagggcttattgataaagaagaatatgaatttcttgtccgtaaa
cttaatgaaaccacagaggaattgagcggggttgcgcaagcgcagagagaagccgagaag
gccggaaaacttgctgccgctcagcaggaagcgcaggctcaggcctttcaaagaatgctg
gacaagatcgaccctctggctgcggcgctaagaaatcttgaacaacagcatgatgaactt
aatgctgcgtttgcatccgggaaaataaatggttctcagtttgagaattatagccgaaaa
atacaggaaacacggcgagagcttaccggagaggctcaggcagagcgagaagcagcaaaa
gcgcatgatgaacaggttgttgctttgcaacgtctgattgctcaacttgatcctgtcgga
actgcttttaatcgtctggtagaacaacagaaacagctcaatgaagcaaaagctaagggg
atgctttctcctgaaatgtatgaggagctttctggaaaacttcgtgctatgcggagtgag
cttgaggttactcaatcacaattaagcaaaaccggaatgtcggcaaaacaaacggctttt
gctatgcgcatgttgcctgcacaaatgacggatattgttgttgggttgtccactggtcag
tcgccatttatggtgttaatgcagcagggcggccattcagctatgcaggagacaagaatc
gccagcttacccgttacagcgatacccgctggcatgaagattccgtgcgtaaccgctggt
tcagcgtga
              
                            

Download fasta file
RegulonDB