RegulonDB RegulonDB 10.9: Gene Sequence
stfR gene sequence


Size: 3363        A: 887  T: 682  G: 929  C: 865

Fasta

 

>stfR E. coli K12. Version NC_000913.3 GI:556503834
atggcagtaaagatttcaggtgtactgaaagacggcacaggaaaaccggtacagaactgc
acaatccagctgaaagcaaaacgtaacagcaccacggtggtggtgaacacgctggcctca
gaaaatccggatgaagccgggcgttacagcatggacgttgagtacggtcagtacagcgtt
attctgttggtggaaggattcccgccgtcacatgccgggaccattaccgtgtatgaagat
tctcaacccggtacgctgaatgattttctcggtgccatgacggaggatgatgcccgtccg
gaggcactgcgccgttttgaactgatggtggaagaggtggcgcgtaacgcgtccgcggtg
gcacagaacacggcagccgcgaagaagtcagccagtgatgccagcacatcagcccgtgag
gcggcaacccatgcggctgatgctgcggactcagcacgcgcagccagcacgtcagccgga
caggccgcgtcgtcggctcagtcagcgtcttccagcgcaggaacggcatcaacaaaggcc
actgaagcatcaaaaagtgctgccgctgcagagtcctcaaaaagcgcggcggccaccagt
gccggtgcggcgaaaacgtcagaaacgaatgcttcagcgtcactacaatcagcagccaca
tctgcatccaccgcgaccacgaaggcatcagaagctgcgacctcggcccgggatgcggcg
gcctcaaaagaagcggcaaaatcatcagaaacgaacgcatcatcaagcgccagtagtgca
gcttcctcggcaacggcggcaggaaattccgcgaaggcggcaaaaacgtccgagacgaac
gccaggtcttctgaaacggcagcgggacagagcgcctcggctgcggcaggctcaaaaaca
gcggctgcgtcgtctgccagtgcagcgtcaacaagtgccgggcaggcctcagccagtgcc
accgccgccggaaaatcggcagaaagcgccgcatcgtctgcttcaacagccacaacgaag
gctggcgaagccactgaacaggccagcgcagcagcgaggtctgcttccgcagcgaagaca
tccgaaacgaacgcgaaagcgtcggaaacaagcgcagaatcctcaaaaacggctgccgca
tcgtcagccagttcggcggcgtcatcggcatcatcggcgtctgcttcaaaagatgaggcg
accagacaagcgtcagcagcgaagagcagcgccacgacggcatccacgaaggcgacagag
gctgctggcagtgcgacggcggcagctcagagcaaaagtacggcggaatccgcggcaacg
cgcgccgagacagcagctaaacgggcagaggatattgcatccgccgtggcgcttgaggat
gcaagtacgacgaaaaaggggatagtacagctcagcagtgcgaccaacagtacgtctgaa
acgctggcggcaacgccaaaggcagtaaaatcagcctatgacaatgcagagaaacgtctg
cagaaagaccagaacggcgctgatatacccgataagggatgcttcctgaacaacattaac
gcggtcagtaaaacagactttgctgataagcgtggtatgcgttatgtgcgggttaacgct
cctgcaggtgcaacatctggaaaatattaccctgttgttgttatgcgttctgctggctca
gtaagcgaactggcatcaagagtcattatcaccacggcaacgcgaaccgcaggcgatccg
atgaataactgcgagtttaacggatttgttatgcctggtggctggactgacagggggcgt
tatgcttatggcatgttctggcaatatcaaaacaatgaacgagccattcactcaataatg
atgagtaataagggcgatgatttgcgctctgtgttctatgttgatggcgctgctttccct
gtttttgcgtttattgaagatggcctgtcaatatccgcacctggtgctgatctcgttgtt
aatgatacgacctataagtttggggcaacaaatccggcgactgaatgtatcgcggcggac
gttatccttgattttaagagtgggcgtggtttttatgagtctcattcgttaatcgttaac
gataacttgtcgtgcaaaaaactttttgccacagacgaaattgtagcgcgtggtggtaat
cagattcgaatgataggtggggagtatggtgcattatggcgtaatgatggcgctaaaact
tacctgctgcttaccaatcaaggtgatgtttatggtggctggaatacattaagaccgttt
gctattgataacgcaaccggcgaactggttattggaaccaaactgtccgcaagtctgaac
ggtaatgcattaacagcaacaaagctgcaaacgccaagacgggtttctggtgttgagttt
gatggttccaaagatattactttaaccgccgcgcatgtggctgcttttgccagaagggca
acggatacatatgccgatgcggatggtggcgttccatggaatgccgaatctggcgcttac
aatgtcacccgctctggcgacagctatattctggttaacttctataccggagtcggaagt
tgccggaccctgcagatgaaggcgcattacagaaatggtggtctgttctaccgttcttca
agagacggttatggttttgaggaagactgggcagaagtttatacctcgaaaaatcttcca
ccagaaagctacccagtcggcgcaccaatcccgtggccatcagataccgttccgtctggt
tatgccctgatgcaggggcaggcttttgacaaatctgcttacccgaaacttgcagccgct
tatccgtcaggcgtgatccctgatatgcgtggctggacgattaagggcaaacctgccagt
ggtcgggccgtattgtctcaggaacaggacggcattaaatcgcatacccacagcgccagc
gcatccagtacagatttggggacgaaaaccacatcgtcgtttgattacggcactaaatcc
acgaataacaccggggcacatacacacagtgtgagcggctctacaaactcggctggagca
cacacacactcactagccaacgtgaacacggctagtgctaactccggtgctggtagtgca
tcaacaagattgtctgttgtgcataatcaaaactatgcaacatcatctgctggcgcacat
acccactcactgtccggcactgctgcaagcgcaggtgcacacgcgcatactgtcggtatt
ggtgctcatacgcactccgttgcgattggttcacatggacacaccatcaccgttaacgct
gctggtaacgcggaaaacaccgtcaaaaacatcgcatttaactatattgtgaggcttgca
taa
              
                            

Download fasta file
RegulonDB