RegulonDB RegulonDB 10.9: Gene Sequence
tfaR gene sequence


Size: 576        A: 163  T: 136  G: 159  C: 118

Fasta

 

>tfaR E. coli K12. Version NC_000913.3 GI:556503834
atggcattcagaatgagtgaacaaccacggaccataaaaatttataatctgctggccgga
actaatgaatttattggtgaaggtgatgcatatattccgcctcatacaggtctgccagca
aacagtaccgatattgcaccgccagatattccggctggcttcgtggctgttttcaacagt
gatgagtcatcgtggcatctcgttgaagatcatcggggtaaaacggtttatgacgtggct
tccggcaacgcgttatttatttctgaactcggtccgttaccggaaaatgttacctggtta
tcgccggaaggggagtttcagaagtggaacggcacagcctgggtgaaggatacggaagca
gaaaaactgttccggatccgggaggcggaagaaacaaaaaacaacctgatgcaggtagcc
agtgagcatattgcgccgcttcaggatgctgcagatctggaaattgcaacggaggaagaa
atctcgttgctggaagcatggaaaaagtatcgggtattgctgaaccgtgttgatacgtca
actgcacaggatattgaatggccagcactgccgtag
              
                            

Download fasta file
RegulonDB