RegulonDB RegulonDB 10.9: Gene Sequence
ynaE gene sequence


Size: 234        A: 97  T: 53  G: 45  C: 39

Fasta

 

>ynaE E. coli K12. Version NC_000913.3 GI:556503834
atgaaatcaaaagacaccctaaagtggttccctgcgcagcttcctgaagtaagaattatc
ctaggggatgctgtagtggaagtagcaaaacagggaagacctatcaataccagaacattg
cttgattacattgaaggaaacataaagaaaacatcatggctggataacaaagaattatta
caaacagcgatatcagttcttaaagacaaccaaaatttaaatggtaaaatgtaa
              
                            

Download fasta file
RegulonDB