RegulonDB RegulonDB 10.9: Gene Sequence
uspF gene sequence


Size: 435        A: 117  T: 107  G: 102  C: 109

Fasta

 

>uspF E. coli K12. Version NC_000913.3 GI:556503834
atgaacagaacgattcttgtccctatcgatatttccgattcagaattaactcaacgcgtg
attagccacgttgaggaagaggcaaagattgatgatgcagaggttcatttcctgacggta
ataccttcactgccctactatgcctctctgggtttagcgtattccgcagaattaccggca
atggatgacctgaaagcggaagccaaatcgcaactggaagagatcattaaaaaatttaaa
ctgccaaccgacagagtgcatgtccatgttgaggaaggctcgcccaaagaccgcattctg
gaattggcgaagaagatccccgctcatatgatcatcattgcttcccatcgaccggatatc
accacttatctgctcggttccaacgccgcagctgtagtgcgtcacgcagagtgctccgtg
ctggttgtgcgctga
              
                            

Download fasta file
RegulonDB